public

This data has moved to another server which houses Zika data for other researchers as well. Please visit the new location for the real-time data: https://zika.labkey.com/project/OConnor/begin.view

You will be automatically redirected in a few seconds.

Welcome to the Zika experimental science team (ZEST) data portal. Given the urgency of the ongoing Zika virus epidemic, we are making our study results available in real-time. Each study and its available data are shown below. For example, the first study performed by the ZEST team is ZIKV-001. If there are data you would like but are not available, please contact us. We are also happy to answer questions about the data as best as possible, but we apologize in advance if we do not have time to answer each and every question.

Questions or comments can be directed to Dave O'Connor dhoconno@wisc.edu. You can also follow the O'Connor lab (@oconnorlab) or Dave (@dho) on Twitter.

Primary objectives

  • Assess the infectivity of a Zika virus isolate from French Polynesia at different doses in rhesus macaques
  • Measure concentration of Zika virus RNA in plasma, urine, CSF, saliva, and feces
  • Determine whether immunity elicited by Zika virus infection protects from subsequent re-infection with genetically similar, Asian-lineage Zika viruses

Study design

Three Indian-origin rhesus macaques will be challenged subcutaneously with different doses of French Polynesian Zika virus. For each of the first 10 days, samples will be collected daily for intensive virologic analyses. From days 11-28, samples will be collected 2-3x per week. After 28 days, the animals will be rested for approximately 6 weeks before being re-challenged with 10E6 PFU of French Polynesian Zika virus.

Result summary

All three macaques were successfully infected with Zika virus. Plasma viremia peaked at more than 1e6 viral RNA copies / mL in two of the three animals. Plasma viremia resolved by approximately 10 days post-infection. In two of three animals, viral RNA was detected in urine slightly longer than in blood. Viral RNA was also detected in salvia from all three animals.

Real-time study results

Primary objectives

  • Assess the infectivity of a Zika virus isolate from Africa at different doses in rhesus macaques
  • Measure concentration of Zika virus RNA in plasma, urine, CSF, saliva, and feces
  • Determine whether immunity elicited by Zika virus infection protects from subsequent re-infection with genetically heterologous, Asian-lineage Zika viruses

Study design

Three Indian-origin rhesus macaques will be challenged subcutaneously with different doses of African lineage Zika virus (Uganda 1947). For each of the first 10 days, samples will be collected daily for intensive virologic analyses. From days 11-28, samples will be collected 2-3x per week. After 28 days, the animals will be rested for approximately 6 weeks before being re-challenged with 10E6 PFU of French Polynesian Zika virus.

Result summary

This study is scheduled to start Monday, March 7, 2016

Real-time study results

Primary objectives

  • Assess whether fetal development is impacted by maternal infection with French Polynesian Zika virus during the first pregnancy trimester
  • Measure concentration of Zika virus RNA in amniotic fluid and virus transmission to the fetus
  • Pilot methods for studying Zika virus infection during pregnancy

Study design

A single pregnant Indian-origin rhesus macaque (approximately 25-30 days post-conception) will be challenged subcutaneously with 10E4 PFU French Polynesian Zika virus. Natural history of Zika virus will be evaluated as in ZIKV-001. Additionally, we will quantify virus in amniotic fluid at multiple timepoints and monitor fetal development by ultrasound imaging.

Result summary

Study is scheduled to begin March 7, 2016

Real-time study results

I'm delighted to report that the California National Primate Research Center Zika virus studies, led by Koen Van Rompay, are also sharing their data in real-time. Who's next? Contact me (dhoconno@wisc.edu) or LabKey Software if you are interested in having your Zika virus data hosted on a new LabKey Server that has been setup for this purpose.

California National Primate Research Center Zika virus studies

--dave

Over the last few weeks I have helped several groups analyze Zika virus sequencing data, as well as working with Shelby to analyze data collected in ZIKV-001 and ZIKV-002. I developed a straightforward and simple workflow in Geneious Pro that can be used for push-button analysis of Zika virus datasets.

Detailed information about the workflow is here [Bitbucket] and the workflow file can be downloaded here [ Geneious Pro]

Let me know if you find it useful!

--dave

AIDS Vaccine Research Laboratory, UW-Madison Dawn Dudley, Shelby O’Connor, Dane Gellerup

Here is the protocol we are using to prepare viral RNA, reverse transcribe, and PCR amplify with five overlapping PCR primer pairs to generate amplicons for Illumina deep sequencing. These primer pairs might be useful for others interested in PCR amplifying Asian-lineage Zika virus. Similar primers for African-lineage Zika virus PCR amplification are under development.

Isolate viral RNA.

  1. Using a QIAamp MinElute Virus Spin Kit, elute vRNA in 25µL Elution Buffer.

Dilute 10µL of 100µM primer into 90µL Nuclease-Free H2O. End result required is 10µM primer.

  1. Forward Primer 1: ACTGCGACAGTTCGAGTTTG
  2. Reverse Primer 1: ATCCAAAGTCCCAGGCTGTG
  3. Forward Primer 2: AGATCCCGGCTGAAACACTG
  4. Reverse Primer 2: CCCATGTGATGTCACCTGCT
  5. Forward Primer 3: TACTCACAGCTGTTGGCCTG
  6. Reverse Primer 3: CACCTCGGTTTGAGCACTCT
  7. Forward Primer 4: TGTTTGGCTGGCCTATCAGG
  8. Reverse Primer 4: CTGCGGATCCTTTCAATGCG
  9. Forward Primer 5: TATGGGGGAGGACTGGTCAG
  10. Reverse Primer 5: ACTAGCAGGCCTGACAACAC

Using an Invitrogen SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity kit, make an rtPCR master mix for all samples. All values are per sample:

  1. 2x Reaction Mix:...………………………………….12.5µL
  2. SuperScript III RT/Platinum Taq Enzyme Mix:…...0.5 µL
  3. Ultra Clean PCR Water:…………………………….8.5 µL
  4. MgSO4 (1.5mM):…………………………………….1.5 µL

Aliquot 23µL Master Mix into PCR strip cap tubes.

Add 0.5µL forward and 0.5µL reverse primer to each tube.

Add 3µL viral RNA to each tube. Mix and spin down.

On a thermocycler, run a program:

  1. 55C for 30 minutes
  2. 94C 2 minutes
  3. 35 cycles of the following:
  4. 94C 15 seconds
  5. 56C 30 seconds
  6. 68C 3.5 minutes
  7. 68C 10 minutes
  8. 10C forever

There has long been a reluctance, born out of experience, that making data from experiments on animals (particularly nonhuman primates) publicly available is inadvisable because of the potential for information to be taken out of context by those who oppose animal research. We have argued vigorously that the public health emergency of Zika virus demands transparent, open data sharing. We ask that those of you who consider using information we provide here to slow research on Zika virus to reconsider. We know nearly nothing about the virology, immunology, and pathogenesis of this virus. Zika virus infection of pregnant women has been associated with severe birth defects, but it is still far from clear how, or how often, Zika virus infection may induce these defects in developing fetuses. There have also been anecdotal reports that Zika virus can be transmitted sexually, and that it is shed in saliva. With the minimal data available, we cannot yet determine how severe the risks of sexual or other non-mosquito transmission of Zika might be. Understanding these critical biological features in animals where we control the dose, route, and timing of infection will accelerate the accumulation of knowledge and hopefully alleviate the suffering of people who are impacted by this virus. Some may not agree that this is sufficient justification for animal research; we can respectfully disagree.

We are grateful for the financial support of:
  1. NIH P51 5P51OD011106-54 to the Wisconsin National Primate Research Center
  2. NIH R01 supplement 3R01AI116382-01A1S1 to O'Connor

The Project Zika experimental science team (ZEST) is comprised on interdisciplinary researchers and clinicians interested in understanding why Zika virus has recently been associated with significant disease. This information will aid in the development and evaluation of interventions to minimize future Zika virus-associated disease.

Project leaders
Dave O'Connor
Jorge Osorio
Ted Golos
Tom Friedrich

Immunology and pathogenesis
Dave O'Connor
Emma Mohr
Dawn Dudley
Adam Bailey
Mariel Mohhs
Meghan Breitbach
Mustafa Rasheed
Sallie Permar (Duke University)

Vector biology
Jorge Osorio
Matt Aliota
Bruce Christensen

Pregnancy and fetal development
Ted Golos
Greg Wiepz
Igor Iruretagoyena
Ei Terasawa

Virology
Tom Friedrich
Andrea Weiler
Gabrielle Lehrer-Brey
Dave O'Connor
Jorge Osorio
Matt Aliota
Shelby O'Connor
Dane Gellerup

Neurobiology
Jon Levine
Shahriar Salamat

Nonhuman primate core
Saverio "Buddy" Capuano
Nancy Schultz-Darken
Jennifer Post

Administrative core
Kristi Hall
Sandra Boehm

Data management
Michael Graham
Mustafa Rasheed
Kirsten Wingate
Josh Eckels (LabKey Software)

Translational core
Emma Mohr
Esper Kallas
Amilcar Tanur
Renato Aguiar
Carlos Moreira