MHC class I -A, -B, and -I


Unfortunately, there are no perfectly conserved sequences in the MHC UTRs that can be used as primer binding sites. For MHC class I allele discovery, we typically use a cocktail of primers that together match the vast majority of known macaque sequences. These primers reliably amplify MHC class I -A, -B, and -I sequences:

Primer Sequence (5’ -> 3’)
5’UTR AGAGTCTCCTCAGACGCCGAG
5’UTRa AtTCTCCGCAGACGCCvAG
3’UTRa CCTCGCAGTCCCACACAAG
3’UTRb CCTGCTTCTCAGTTCCACACAAG
3’UTRc CTGCATCTCAGTCCCACACAAG

MHC class I -E


MHC-E sequences have distinctive UTR sequences and require the use of a different primer set:

Primer Sequence (5’ -> 3’)
E-5’UTR CACGACTCCCGACTATAAAG
E-3’UTR TTGCACACAAGGCAGCTGTC

MHC class II


Alleles at each MHC class II locus have similar UTR sequences; however, the loci vary enough from each other that different PCR primers are necessary to amplify each MHC class II locus:

Primer Sequence (5’ -> 3’)
DRA-5’UTR CCGAGCTCTACTGACTCCCAA
DRA-3’UTR AAGAAACACCATCACCTGCAT
DRB-5’UTR CTGGTCCTGTCCTGTTCTCC
DRB-3’UTR AAAGCTGGGGCAGAAGGTT
DQA-5’UTR GAGGCTGCCTTGGGAAGA
DQA-3’UTR CCTAGGTCATGTAGCAAGTCCA
DQB-5’UTR CCACTACTTTTCCCTTCGTCT
DQB-3’UTR CCAGTTAAAATAGTCTCAGGAGTCA
DPA-5’UTR CATCAATTAGAGACCCCACAAC
DPA-3’UTR TCCTAAGTCCTCTTCTGTTCAG
DPB-5’UTR GCAGCTCTTTTCATTTTGCCATCC
DRB-3’UTR GTCCTGGAACCAGGTGCTAACG
Additional primers, including barcoded primers for multiplex sequencing on various platforms, can be found here.